Sunday, October 13, 2019
Lord of The Flies Book Report :: Book Review
Character Page Ralph Ralph is a fair boy of about twelve. He is the first character introduced in the story and is a dominant leader throughout most of the book. He finds the conch, a symbol of order and authority. He blows the conch and holds an assembly in which he is voted chief. Ralph stays focused on getting rescued and building shelters while most of the others play and hunt. By the end all the boys have either turned against him or died. Piggy Piggy is a large, timid boy, with asthma and specs (eye glasses). He is Ralph's loyal sidekick from the start. His brilliant mind and logical thinking are trapped inside his unattractive body. He is disrespected and rejected because of his looks, and used for his glasses, which are the only means of starting the fire. Piggy struggles to stay strong and clear through the madness and chaos. Jack Jack is the leader of the choir boys who become the first band of hunters. He is intent on becoming savage and killing pigs for meat. He neglects the fire, their only hope for rescue, and goes hunting instead. Jack rebels against Ralph and forms his own tribe at the other end of the Island. His tribe hunts all day and holds feasts and dances every night. His violent instincts show up in murder and destruction as civilization runs out of him. Simon Simon is mysterious and spiritual. He is a small boy with incredible, silent, courage and strength. He starts out a part of Jack's choir, then becomes loyal to Ralph when he is elected chief. Simon helps Ralph with the shelters and is admired by the littluns. He has a spiritual encounter with the Lord of the Flies, which is a pig's head on a stick. This encounter is one of the most symbolic incidences in the book. The head is the beast that all the littluns fear and represents the inner instincts and evils in man. Samneric In the beginning Sam and Eric are recognized as two separate people, two twin brothers. By the end they are referred to as Samneric, a single being. They were loyal to Ralph in the beginning and throughout most of the book. Towards the end they are captured by Jack's tribe and join in on a hunt for Ralph. They are weak and easily swayed by forceful power. Plot The book opens with the description of a beautiful island with pink rocks, warm pools, and a long, palm lined, beach protected by a coral reef.
Saturday, October 12, 2019
Cloning, Triumph or Tragedy? Essay -- Argumentative Persuasive Clone G
Cloning, Triumph or Tragedy? The creation of life through scientific experiments is not a new concept. The idea has been in existence as far back as two hundred years. Mary Shelley was far ahead of her time when she brought the human like creature to life in her writing of "Frankenstein, The Modern Prometheus." The story of "Frankenstein" was written as a myth, yet it continues to leave the world intrigued today. The idea of creating human or animal life is now in the making, except there is a twist to creating this new life. It is known as cloning, bringing an exact replica of cells to life to create an animal or a human that is already in existence. Though human life has not yet been a part of cloning, the cloning of one lamb has recently occurred. The advantages to cloning as well as many ethical dilemmas will be discussed, According to one document, "The technology to clone is simple, though far from perfect." Various views will also be shared from J. Michael Bishopà ¹s"Enemies of Promise." Scientists will express their beliefs in the advancement of technology and the use of science in todayà ¹s world. Many definitions of cloning have been brought to light by groups and organizations. The American Medical Association defines it as "the production of genetically identical organisms via somatic cell nuclear transfer." Cloning is the method of producing a baby gene that has the same gene as its parent. The idea of cloning all began in 1997 with embryologist, Ian Wilmut, from Roslin Institute in Scotland. He and his colleagues were the first to clone a lamb they named "Dolly." Before this experiment was proven successful, cloning was thought to be an impossible endeavor. It is true that the technology to clone does exist, but ... ... it is human failure that causes problems in our society. People need to think harder about the reality and the effects cloning could have on society before cloning itself becomes real. If human cloning ever does become legalized and takes place, I surely hope that science doesnà ¹t take the bad à ³rapà ² for it, but the failure of humans instead. We saw Victor Frankensteinà ¹s failures, we saw other accounts of failures. Maybe we should learn from the various examples, that human life is extremely fragile and to distort it could change the human race forever. Works Cited Bishop, J. Michael. à ³Enemies of Promise.à ² 237-242 Farnsworth, Joseph (2000, April) To Clone or not to Clone. http://farnsworth.tripod.com/Humancloning/cloning_m.htm Marty, Martin (1997, May) A Wolf in Sheepà ¹s Cloning. http://thelutheran.org/9705/page26.html Shelley, Mary. à ³Frankenstein.à ² 231-235
Friday, October 11, 2019
Education Requirement Essay
1. Should there be a minimum education requirement for the beauty therapist job? Discuss Before answer this question, we should discuss about job analysis. Job analysis is the systematic process of determine skills, duties and knowledge required to performing jobs in organization. One of the purposes job analysis is to answer what qualifications are need to perform the jobs Back to our question, owner of Tangerine Center Sdn Bhd want to upgrade their business service. She want to offer more service such as spa, beauty consultant, skin therapist and medical esthetics. Based on new job descriptions and job specifications, beauty therapist should have minimum education requirement. 2. What is your opinion of Jennyââ¬â¢s effort to upgrade the people in the organization?. Jennyââ¬â¢s effort to upgrade the people in organization is good for her business. Maybe after upgrade her staff, her business can get more income. She should consider human resource management function before proceed with upgrading plan. i. Staffing She should ensure always has proper number of staff with appropriate skill, qualified and suitable number of staff. She also should have good job analysis to ensure his mission will accomplish. ii. Human Resource Development Training is important part in staff development. She should give more training to her staff in order to improve their skill. Her staffs have basic knowledge and skill as beautician. Enhancement program will improve their ability and soft skill knowledge. Another important part in human resource development is organization development. She should make her business more effective. Improve in tool and equipment will make her business more competitive. iii. Compensation When she upgrade her staff qualification, she should pay higher than staff with basic qualification. Total staff cost will increase and she should have proper plan to increase revenue. As conclusion, Jennyââ¬â¢s effort will give good effect to her business when she upgraded the people in the organization. 3. What legal ramifications, if any, should Jenny have considerer? As an employer, Jenny should be aware of the rules and guideline for hiring and recruiting an employee. This is for major law to follows ; i. Employment Act 1955 : A Guide To Malaysian Labour Laws ii. Workmenââ¬â¢s Compensation iii. Children and Young Persons (Employment) Act 1966 (Revised 1988) iv. Occupational Safety and Health Act 1994
Thursday, October 10, 2019
Bio 201 Final Review
Which of the following is most likely to occur when a tumor-suppressor gene is mutated? ââ¬â The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. ââ¬â TRUE ________can convert proto-oncogenes into oncogenes. ââ¬â Nonsense mutations Most human embryos that are aneuploidy ââ¬â are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. ââ¬â FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? ââ¬â 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. ââ¬â BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? ââ¬â mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called ââ¬â maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â â¬â are on the same chromosome. An episome is ââ¬â a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. ââ¬â FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. ââ¬â an F factor What can be inferred from an organism that has undergone a gene knockout? ââ¬â The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? ââ¬â identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? ââ¬â G1 Certain types of cancer are caused by viruses. ââ¬â TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as ââ¬â both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to ââ¬â get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? ââ¬â random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain ââ¬â All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. ââ¬â FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. ââ¬â TRUE Which of the following does not contribute to the infectious ability of prions? ââ¬â Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that ââ¬â their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? ââ¬â Plant cells are totipotent. Which of the following is an advantage of molecular pharming? ââ¬â The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp ââ¬â base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. ââ¬â FALSE A gene created from the fusion of two gene fragments is considered a ââ¬â chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. ââ¬â FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. ââ¬â 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? ââ¬â F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that ââ¬â two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. ââ¬â FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is ââ¬â codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance ââ¬â can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â â¬â competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that ââ¬â their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. ââ¬â TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? ââ¬â xeroderma pigmentosum Cancers originate from a single cell. ââ¬â TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? ââ¬â two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? ââ¬â centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? ââ¬â 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? ââ¬â Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. ââ¬â TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because ââ¬â All of the statements given are true. Quantitative traits ââ¬â are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | ââ¬â 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. ââ¬â TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is ââ¬â a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. ââ¬â TRUE Which of the following is a possible use for gene cloning? ââ¬â All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? ââ¬â Every band matches. What is required for a group of clones to be considered a contig? ââ¬â The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? ââ¬â nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be ââ¬â metastatic. The process by which haploid cells are produced from diploid cells is called ââ¬â meiosis In a haploid dominant species ââ¬â the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that ââ¬â alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? ââ¬â both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? ââ¬â either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called ââ¬â epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. ââ¬â 3,2Drugs that are HIV protease inhibitors ââ¬â prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. ââ¬â TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â¬â TRUE The entire collection of a species' proteins is known as its ââ¬â proteome Which of the following pollutants could be reduced with the use of bioremediation? ââ¬â All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. ââ¬â TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? ââ¬â a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. ââ¬â FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) ââ¬â oncogene The formation of the bivalent during meiosis ââ¬â contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. ââ¬â 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. ââ¬â TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. ââ¬â FALSE Which of the following statements correctly describes a quantitative trait? ââ¬â People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. ââ¬â a sex pilus, single strand of DNA Integrase ââ¬â cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? ââ¬â cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage ââ¬â TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. ââ¬â FALSE In mammals, males are ________ and females are ____________. ââ¬â hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. ââ¬â 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. ââ¬â cytoplasm Place the following events of bacterial transformation in order from first to last. ââ¬â DNA replication b â â¬â an enzyme joins F factor DNA ends c ââ¬â sex pilus shortens d ââ¬â DNA transfer e ââ¬â an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? ââ¬â plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? ââ¬â They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? ââ¬â tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. ââ¬â two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. ââ¬â TRUE The sex of all animals is determined by chromosomes. ââ¬â FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? ââ¬â missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? ââ¬â Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that ââ¬â the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission ââ¬â All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. ââ¬â supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? ââ¬â A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. ââ¬â checkpoint proteins In mitosis, the main difference between plant and animal cells is that ââ¬â plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? ââ¬â the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? ââ¬â Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? ââ¬â direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce ââ¬â a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? ââ¬â 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in ââ¬â an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant ââ¬Å"rescueâ⬠could have been caused by â⠬â addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? ââ¬â Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? ââ¬â cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone ââ¬â gene amplification. All of the following are chemical mutations EXCEPT ââ¬â X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? ââ¬â Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is ââ¬â pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? ââ¬â Triple X syndrome Prokaryotes ââ¬â include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to ââ¬â All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. ââ¬â S Sexual life cycles include both haploid and diploid stages. ââ¬â TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce ââ¬Å"Labradoodlesâ⬠is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow ââ¬Å"Texas Beautyâ⬠rose with a true-breeding ââ¬Å"Rubyâ⬠red rose, you get all red roses. But when you cross a ââ¬Å"Texas Beautyâ⬠yellow with the yellow variety ââ¬Å"Jealousy,â⬠you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? ââ¬â The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? ââ¬â All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins ââ¬â do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because ââ¬â if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. ââ¬â IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because ââ¬â HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in ââ¬â the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? ââ¬â polymerase chain reaction (PCR) Polyploidy in plants ââ¬â All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, ââ¬â chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because ââ¬â they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? ââ¬â 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? ââ¬â A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.
Wednesday, October 9, 2019
How Important Is It to Maintain Confidentiality in a Childcare Setting? Essay
How important is it to maintain confidentiality in a childcare setting? When in a childcare setting it is vital to maintain confidentiality in different areas not just for the Childââ¬â¢s welfare but the families as well! Confidential information must not be shared outside of the setting E.G family or friends. The following examples are to be kept confidential; enrolment forms, familyââ¬â¢s health insurance information, health screenings and records, including immunization records, emergency contact information, contact information for those authorized to pick up child, emergency care consent forms , consent forms (permission slips) for outings or special activities, names of regular medical or dental providers who know the child, nutritional restrictions, progress reports, child observation logs, parent conference logs, medication logs, documentation of medical, behavioural or developmental evaluations, referrals or follow-ups, addressing issues relevant to the childââ¬â¢s participation in the program, documentation of any injury occurring at the program site and the steps taken to address the situation. While the rights and desires of families to keep their personal details private are important, there are also some circumstances under which identifying information should be shared for example; Program staff and the ââ¬Å"need to know (might have a dietary or medical requirements so the cook or nurse will need to know) Outbreaks of reportable illness or Outbreaks of reportable illness as the information might be vital and used to saved the childrenââ¬â¢s life or keep them healthy. One way to differentiate whether the information is confidential or not would be to think ââ¬Å"Is this common knowledge or do I know it because my position in the settingâ⬠as all children, families and young people have a right to confidentiality. So always ask your supervisor if you arenââ¬â¢t sure about what information is appropriate to disclose to different people. In addition all information needs to be store properly- in a secure place. If this isnââ¬â¢t possible make sure you donâ â¬â¢t discuss the information apart from those directly responsible for the care of the child. Technology is advancing but this still doesnââ¬â¢t escape the laws. Read more:à Maintaining an Individualââ¬â¢s Confidentiality and Disclosing Concerns There is legislation that defines in what ways personal information can be used; The Data Protection Act 1998 (was created to protect individualââ¬â¢s rights and to prevent breaches or information.) It applies whether or not they are kept on the computer Maintaining confidentiality protects children and their families from gossip but also prevents situations of an abuser mounts a legal defence based on tampering of evidence so it is essential that you donââ¬â¢t talk to anyone other than those directly involved about your concerns or about what a child has told you. As anything you learn about children or their families or other during the course of your practice is likely to be very confidential. When working with other professional it is most likely you will hear comments and remarks that arenââ¬â¢t anticipated to be repeated outside of the meeting/ conversation. You may be given documents that cover sensitive areas- this means that you need to keep the information confiden tial but also in a safe and secure lock up. Photography is an ever increasing technology and can be a brilliant way to have evidence for observations or practicalââ¬â¢s but there are some basic rules that you have to follow to maintain confidentially when taking photographs; ALWAYS Have permission from the parents of the child that you a photographing, Only use a school camera as this ensures that the photographs donââ¬â¢t make it out of the school, although the parent says it okay the child might not when you are taking the photo always keep this in mind, If the parent(s) donââ¬â¢t want their child to be in the picture then make sure that they STAY OUT of it or you can cut/ bur them out of the photo. When doing observations you need to maintain confidentiality in the following ways; only using the Childs first names, change the childrenââ¬â¢s names if they are unusual or could lead to the child be identified in any way, give the type of setting rather than the name of the settings EG ââ¬Å"a primary schoolâ⬠rather than ââ¬Å"The John Warner primary schoolâ⬠. Write the childrenââ¬â¢s age as years and months rather than the date of birth as they can be easily identified, photographic records should not be used unless permission is gained from the childââ¬â¢s parents and the setting lastly make sure the files have a contacting telephone number so they can be returned safely if lost. Lastly it is vital that as a practitioner that we maintain confidentiality as our main priority is the welfare of child and their development. If you breach confidentiality then you are putting the child at a very high risk, whether this is of kidnapping, sexual, emotional or physical abuse, there are laws and moral rules for a reason as it should be the childââ¬â¢s interest at heart at all times. Secondly you should always maintain confidentiality to keep a good relationship with the parents. You are in charge of the apple of their eye and they are trusting you with the Childs life thus it is vital to maintain a good and healthy relationship with the c hildââ¬â¢s parents. If you donââ¬â¢t this might result with them taking them out of the current school and you losing your job. Overall you should always make sure that the person who is picking the child up has the right of access as this could lead into very bad situations of the child being abducted. It is vital that you donââ¬â¢t break the trust with the family. The child might suffer abuse so you should take the right steps (Talking to your child protection officer) and no one else unless directly involved with the childââ¬â¢s welfare. When passing on information make it is to the correct people as the child might not be telling the truth and putting the child and family in danger for no reason. Donââ¬â¢t repeat anything your team says that you think is confidential. If you hear something that is being talked about them distract them- if it is a parent just talk to them about how well their child is doing but if it is a member of staff take them to one side and talk to them. With any serious or sensitive issues with children ( break ups, deaths etcâ⬠¦) then you need to tell your supervisor immediately and instead of asking the child to tell you a good way to get their emotions out is to write it down ( if old enough). Always ensure that childrenââ¬â¢s names are remained confidential e.g.; in observations etcâ⬠¦ If you are going arrange to talk to anyone about a confident matter then always arrange a confidential area so no one will come in and hear/ see what you are discussing. Always obtain permission for photographs/ videos of a child. Make sure there is no mistrial as to many questions could lead a child on and not tell the truth, get a professional in to deal with the matter. Lastly the data protection acts has 8 principles that state all about maintain confidentially with any documentation in any situation, this is the law. Overall it is vital that you as a professional practitioner you always maintain confidentiality of the setting/ children/ families as it can put many people at risk or a endless list of dangers.
Researching a one company and Solving 3 Questions Essay
Researching a one company and Solving 3 Questions - Essay Example McKnightââ¬â¢s management principles were firstly to delegate responsibility and to encourage staff to exercise their initiative and secondly for management to learn to focus on supporting staff who have participated in failed projects move on to something else rather than punishing them (ââ¬Å"McKnight Principlesâ⬠5). To reinforce its culture of intrapreneurship 3M has instituted several policies and philosophies. The three that jump out of 3Mââ¬â¢s organizational culture are the 15 percent option, tolerance for failure and rewards for success. The 15 percent option give employees authority to 15 percent of their workweek on individual projects of their choice without the need to either disclose or justify it to a manager (Govindarajan and Lang 3). This policy gives 3M staff freedom to be innovative. Tolerance for failure philosophy guarantees employees their jobs and no punishment for a product that fails in the market. On the contrary, 3M has often repeated stories of famous failures that went on to become highly successful products. This policy has the effect of keeping initiative and creativity alive among 3Mââ¬â¢s staff. For innovative products that go on to have a breakthrough in the market, 3M acknowledges team member through salary raises, promotions, and recognition. For example the Golden Step award is given to team members if a newly launched product reaches a revenue goal of $2 million in the US or $4 million worldwide (Govindarajan and Lang 3). Better yet the informal recognition given to successful entrepreneurs through stories that convert them from mortals to legends is considered more powerful by 3M staff. The two major benefits that 3M derives from its organizational culture are staff loyalty and product differentiation as the key to commercial success. Staff loyalty is a manifestation of high staff motivation which often leads to increased job performance. Having a highly committed staff 3Mââ¬â¢s management find it easy to
Monday, October 7, 2019
Summary Coursework Example | Topics and Well Written Essays - 1750 words
Summary - Coursework Example As per the requirements of US GAAP and Securities and Exchange Commission, the income statement of PepsiCo shows the comparative financial performance of the company over last three years, i.e. 2009, 2010 and 2012. There is one extra ordinary item is also included with the head of ââ¬Å"bottling equity incomeâ⬠. However, this item was of non-recurring nature such that it was present in the income statements of 2009 and 2010 but in 2011, this figure was not shown by the company. The requirement to show both basic and diluted earnings per share is also provided in the income statement of PepsiCo. There are few optional items also presented by the company in order to provide more meaningful picture of the company especially to its shareholders such as weighted average number of ordinary shares outstanding and dividend per share declared by PepsiCo over last three years. Contingencies Contingencies, is a specific type of liability under which account head is presented on the face o f the balance sheet but its amount is not showed. Generally, contingencies include those items the results of which can go either in favor or against the company such as lawsuits, long-term contractual obligations, commitments etc. However, contingencies are presented only when their respective amounts are probable and can be reliably estimated as well. PepsiCo has also provided contingencies on its balance sheet under the name of commitments and contingencies. There are different kinds of contingencies under which PepsiCo is obligated, such as non-cancelable commitments. These non-cancelable commitments include commitments for operating leases of building, purchasing agreements with the suppliers of sugar and sweeteners, oranges and its juices and related packaging material. Non-cancelable marketing agreements are also signed by PepsiCo mainly for its sports based marketing. There are some items, which have not been included under contingencies by PepsiCo such as bottler funding an d medical plan related liabilities for retirees. Bottler funding is that agreement which is negotiated by PepsiCo with its suppliers on yearly basis. Medical plan is not included because expected future cash outflows in this regard are not represented as long-term contractual obligations. Off-balance sheet transactions and items are also not included in the commitment and contingencies because PepsiCo has not made it its practice to include in its financial statements unless they constitute under the normal course of business of PepsiCo. INTANGIBLES Being a multi-national entity, PepsiCo has acquired different sorts of intangible assets such as brands, computer software, franchises, goodwill etc. The company has developed various criteria in order to value its intangibles, which are discussed below. Brands PepsiCo develops certain brands the cost of which is normally expensed out by the company in the year in which the brand is developed. Certain brands are acquired by PepsiCo such that their goodwill is recognized separately in the balance sheet. With respect to the life of brands, there are two types of brands i.e. brands with definite life and brands with indefinite life. PepsiCo has the specific brand valuation criteria, which it follows in order to assess the life of the brand. Generally, the brands with definite lives are amortized over a period ranging from 5 to 40 years are
Subscribe to:
Posts (Atom)